Detailed Product Information
HySigen CRISPR Library Cell Pool is established through the CRISPRSeek™ platform with a standardized batch production workflow. The process begins with the preparation of high-coverage, high-uniformity library plasmids using HySigen’s proprietary high-efficiency competent cells. These plasmids are then packaged with a lentiviral packaging kit to generate high-titer CRISPR library viruses. Finally, through HySigen’s exclusive cell pool preparation process, the target cell line is infected at a low multiplicity of infection (MOI), ensuring that each cell receives only a single viral integration. HySigen CRISPR Library Cell Pools demonstrate minimal batch-to-batch variation and excellent reproducibility. By applying different selective pressures to these cell pools, researchers can efficiently identify target genes relevant to a wide range of research fields.
Library Name
|
Human Epigenetic Knockout Library
|
Product Name |
Human Epigenetic Knockout Library #UM-UC-3
|
Library Type |
Knockout Library
|
Cell Line |
UM-UC-3
|
Species | Human |
Culture Method |
Adherent |
Morphology |
Epithelial-like |
Coverage | 300× |
Targeted Genes |
2508,8gRNA per gene
|
Non-targeting gRNA Number | 200 |
gRNA Number |
20051
|
Culture medium |
DMEM-H+10% FBS+1% P/S
|
Antibiotic Concentration
|
0.5 μg/mL Puromycin
|
T0 Coverage
|
99.79% |
Uniformity |
4.91
|
Verification Primers |
Forward prime:ATTTCTTGGGTAGTTTGCAGTTT
Reverse primer:GACTCGGTGCCACTTTTTCA PCR Fragment: 213 bp The primers are designed for PCR amplification of library fragments prior to NGS sequencing. The resulting amplicons can be purified and directly applied to subsequent NGS analysis. |
For research use only. Not intended for use in humans or animals, including but not limited to clinical trials, therapeutic, or diagnostic applications.
Cell Reception
Upon receiving the cells, please check if the packaging is intact, if the dry ice is sufficient, if the cryopreservation tube is damaged, and verify the label information and quantity on the tube to ensure it matches the packing list. If there are any abnormalities, please contact us promptly.
If not conducting experiments immediately, store the cells at -80°C or in liquid nitrogen.
Product Usage Method Reference
Experiments should be conducted in a local Class 100 clean environment (such as a biosafety cabinet), and attention should be paid to aseptic operations.
Revival of Library Cells
(1) Pre-warm a water bath and complete culture medium to 37°C prior to initiating the experiment.
(2) In a biosafety cabinet, prepare a 15 mL centrifuge tube containing 10 mL of pre-warmed complete culture medium.
Note: It is advisable to remove cryovials from liquid nitrogen storage in advance, place them temporarily at –80°C, and initiate recovery only after residual liquid nitrogen has fully evaporated.
(3) Retrieve the cryovial from the –80°C freezer and immediately immerse it in a 37°C water bath. Gently agitate until the cell suspension is almost completely thawed. Ensure that the water level does not exceed the cap line of the cryovial.
(4) Disinfect the exterior of the cryovial, then carefully open it inside the biosafety cabinet to prevent overflow. Gently pipette the contents several times and transfer into the prepared 15 mL tube. Rinse the inner wall of the cryovial with 1 mL of complete medium and combine with the cell suspension.
(5) Centrifuge at 250 × g for 5 min. Discard the supernatant and gently resuspend the pellet in 2 mL of complete culture medium. (Optionally, assess viability using trypan blue staining and perform cell counting.)
(6) Seed the resuspended cells into an appropriate culture vessel. Gently move the vessel in a “cross” pattern to distribute cells evenly. Incubate at 37°C with 5% CO₂ and saturated humidity.
(7) After 24 h, examine cell morphology under a microscope and document by imaging. Replace the medium and continue culture. Report any abnormalities promptly.
Library Cell Passage
(1) Preheat 1× PBS, trypsin, and complete culture medium.
(2) Aspirate the original culture medium. Wash the cells 2~3 times with 1× PBS.
(3) Aspirate the 1× PBS. Add trypsin. Gently rotate to cover the cell surface with trypsin, digest, and observe under a microscope until about 70%~80% of the cells become round, then lightly tap the outer wall of the culture vessel to detach the cells.
Note: It is recommended to add complete culture medium at twice the volume of trypsin to stop digestion.
(4) When cells are observed to detach significantly, immediately add preheated complete culture medium to stop digestion. Use a pipette to aspirate the liquid and gently pipette the bottom wall of the culture vessel repeatedly to fully detach the cells from the vessel bottom.
(5) Transfer the cell suspension to a centrifuge tube. Rinse the bottom wall with 1× PBS and collect the cell suspension into the centrifuge tube.
(6) Centrifuge at 250 g for 5 min.
(7) Carefully discard the supernatant, add 1~2 mL of complete culture medium to resuspend the cells.
(8) Select an appropriate culture vessel, add an appropriate amount of complete culture medium, and inoculate the cells according to the appropriate passage ratio (generally 1:2), shake the cell culture vessel in a "cross" pattern to distribute the cells evenly.
(9) Place the cells in an incubator at 37°C, 5% CO2, and saturated humidity.
Library Cell Freezing
(1) When cells grow to a confluence suitable for passage, digest and prepare for freezing.
(2) Digest the cells, take a small amount of cell suspension for counting. Centrifuge the cell suspension at 250 g for 5 min.
(3) Carefully discard the supernatant. Resuspend the cells with 4°C precooled freezing solution, generally at a freezing density of 5×10^6 cells/mL.
(4) After labeling the cryopreservation tubes, aliquot the cells into the cryopreservation tubes and tighten the caps.
(5) If using HyCyte® One-Step Freezing Solution, place the cryopreservation tubes directly upright into a -80°C freezer.
(6) If using a programmed freezing solution, place the cryopreservation tubes into a programmed cooling box before placing them in a -80°C freezer.
(7) After 24 h, the cells can be transferred to liquid nitrogen for long-term storage.
Library Cell Drug Screening
(1) Determine the drug screening concentration and duration. The screening concentration can be selected based on common concentrations in the literature or determined by values such as IC50 or IC80 of the drug on the cells; the screening duration is recommended to be 2-4 weeks.
(2) Calculate the required cell amount based on the number of experimental groups and control groups set in the experiment (cell amount = number of gRNAs * 300 * N).
Note: 300 represents a library cell coverage of 300×, and it is recommended that each group maintains at least 300× coverage corresponding cell amount during drug screening.
Note: To ensure gRNA coverage and uniformity in the library cells during the drug screening period, the expansion passages should not be too high, and it is recommended to control within 5 passages.
3)Expand the library cells to the required cell amount, and divide the cells equally into X portions according to the set number of experimental groups.
4)Screen the experimental group library cells according to the determined drug screening concentration and duration, and culture the control group cells synchronously.
5)After drug screening ends, collect all experimental group cells and control group cells with at least 300× coverage.
6)Extract the genomes from the above cells respectively for downstream NGS library construction and sequencing.
CRISPRSeekTM Product Strength

For product instructions, please refer to the [HySigen CRISPR Library Screening Technology Application Guide (2024–2025) ].
FAQs
Q: How are library cell pools quality controlled, and what are the quality standards?
A: Quality control of library cell pools includes NGS sequencing to evaluate sgRNA coverage, which is generally required to be greater than 90%. In addition, Hycyte’s library cell pools undergo bacterial and mycoplasma testing, as well as viability validation, to ensure the delivery of high-quality cell pools.
Q: Why is an MOI corresponding to ~30% infection efficiency chosen for library cell pool construction?
A: During library cell construction, it is critical to ensure that each cell receives only one sgRNA. An infection efficiency of 30% indicates that approximately 30% of cells are infected by the virus, significantly reducing the likelihood of multiple viral integrations in a single cell.
Q: Can delivered library cell pools be further expanded?
A: Yes, library cell pools can be further expanded; however, it is recommended not to exceed three passages, as excessive passaging may result in reduced sgRNA coverage in the cell population.
Q: Should antibiotics be used for maintenance during cell pool expansion or pressure screening?
A: During expansion of library cell pools, antibiotic selection can be applied to ensure that wild-type cells are eliminated. However, during pressure screening, antibiotic selection is not recommended, as it may interfere with experimental results.
Q: How is the number of wild-type cells required for virus infection calculated?
A: The required number of wild-type cells for library virus infection can be calculated using the following formula: Required wild-type cell amount = gRNA number * gRNA coverage / Virus infection efficiency(30%)
Q: How can sgRNA coverage be maintained in poorly infectable cell lines?
A: Optimize viral infection methods (e.g., spinoculation, use of transduction enhancers) to reduce the MOI required for efficient infection.
Perform pilot experiments to evaluate infection efficiency and determine the appropriate MOI before large-scale screening.
Q: Why is a pre-experiment necessary in drug screening?
A: The purpose of conducting a pre-experiment in drug screening is to determine the appropriate drug concentration. This helps avoid concentrations that are too low to exert a significant cytotoxic effect, or concentrations that are too high and cause extensive cell death, which would make it difficult to collect sufficient cells for subsequent NGS sequencing analysis.
Q: What is the recommended duration for drug screening?
A drug screening duration of no less than two weeks is generally recommended.
Q: What are the methods for screening library cells?
A: Screening methods for library cells include serial passaging, drug screening, viral infection, flow cytometric sorting, and in vivo screening.
Relevant products and service
Hycyte offers off-the-shelf libraries, including human and mouse genome-wide plasmid libraries as well as selected sub-libraries, along with one-stop customized screening services covering CRISPR-KO, CRISPRa, and CRISPRi. Our services include high-throughput sgRNA library construction, virus packaging, cell infection, drug screening, NGS sequencing, and data analysis. A variety of deliverables are available to meet diverse research needs. (CRISPRSeek library screening service)