Accelerate research, empower industry
|
|
Overview Hysigen introduces the innovative "VIRUS-Free™ system," a groundbreaking experimental model designed to significantly enhance the knockout efficiency of cell lines. Key Advancements
Our achievements Hysigen boasts a portfolio of over 5000+ successful cases across commonly used transfection-suitable cell lines. These include Jurkat, NK-92, BV2, C2C12, EMT6, B16-F10, ARPE-19, HepG2, THP-1, HCT116, A549, RAW264.7, MDA-MB-231, MDA-MB-468, 4T1, and more. Know more about 1000+ Off-the-shelf gene-edited cell lines. Workflow
* We kindly remind you that we provide gene editing services for primary cells, stem cells, or iPS cells.
 CRISPR-Mediated Gene Knockout CRISPR-mediated gene knockout involves using a synthetic guide RNA (gRNA) to direct the Cas9 enzyme to a specific location on the target gene's DNA. Once guided to the target site, Cas9 induces a precise double-strand break (DSB) in the DNA. Subsequent natural repair mechanisms, such as Non-Homologous End Joining (NHEJ) or Homology Directed Repair (HDR), are activated. NHEJ often introduces small insertions or deletions, disrupting the gene's reading frame and rendering it non-functional. The success of gene knockout is confirmed through molecular techniques, verifying the presence of mutations and the functional inactivation of the targeted gene. Our CRISPR/Cas9 system is highlighted by utilizing dual gRNAs to create dual DSBs to achieve 100% knockout of the target sequence. Experimental design Strategy
Identification results PCR screening
Final Clone Sequences #4C7: AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT
*Point mutation: V617F hSMARCA2 knockout MDA-kb2 cell line
• Using transcript SMARCA2[NM_003070.5] as a reference, one guide RNA with minimal off-target effects was designed upstream and downstream of exons 6 and 9, respectively, to achieve homozygous knockout (Fig. 1). • Individual clones were screened by PCR (Fig. 2) and Sanger sequencing (Fig. 3) to identify homozygous knockouts of exons 6–9 in SMARCA2. • The absence of hSMARCA2 gene expression in the selected clones was confirmed via Western Blot (Fig. 4). Figure 1. Targeting strategy for hSMARCA2 knock-out
Figure 2. PCR detection for hSMARCA2 -/- MDA-kb2 cell line
Figure 3. Sanger sequencing for hSMARCA2 -/- MDA-kb2 cell line TGCTAAGAGTGAGCAAGGACATTTGACTTCCCCAC-del 7338 bp- GTCTAGTTAGTGGTTGATACTGTGTGTTCATGATAA
Figure 4. hSMARCA2 knock-out protein expression validation
|
|
|
|
|
|
|
|
|
|
IF: 45.5 Chen Y, Chen S, Liu Z, Wang Y, An N, Chen Y, Peng Y, Liu Z, Liu Q, Hu X. Red blood cells undergo lytic programmed cell death involving NLRP3. Cell. 2025 Apr 16:S0092-8674(25)00389-7. | IF: 39.3 Ma B, Ju A, Zhang S, et al. Albumosomes formed by cytoplasmic pre-folding albumin maintain mitochondrial homeostasis and inhibit nonalcoholic fatty liver disease[J]. Signal Transduction and Targeted Therapy, 2023, 8(1): 229. | IF: 26.6 Wu W, Pu Y, Gao S, et al. Bacterial Metabolism-Initiated Nanocatalytic Tumor Immunotherapy[J]. Nano-Micro Letters, 2022, 14(1): 1-21. | IF: 37.3 Zheng Z, Zeng X, Zhu Y, et al. CircPPAP2B controls metastasis of clear cell renal cell carcinoma via HNRNPC-dependent alternative splicing and targeting the miR-182- 5p/CYP1B1 axis[J]. Molecular Cancer, 2024, 23(1): 4. | IF: 18.9 Sun J, Yang F, Wang L, et al. Delivery of coenzyme Q10 loaded micelle targets mitochondrial ROS and enhances efficiency of mesenchymal stem cell therapy in intervertebral disc degeneration[J]. Bioactive Materials, 2023, 23: 247-260. | IF: 18.9 Wei X, Wang L, Duan C, et al. Cardiac patches made of brown adipose-derived stem cell sheets and conductive electrospun nanofibers restore infarcted heart for ischemic myocardial infarction[J]. Bioactive Materials, 2023, 27: 271-287. | IF: 16 Gao Y, Zhu Y, Wang H, et al. Lipid-mediated phase separation of AGO proteins on the ER controls nascent-peptide ubiquitination[J]. Molecular Cell, 2022, 82(7): 1313-1328. e8. | IF: 15.1 Chen X, Hao Y, Liu Y, et al. NAT10/ac4C/FOXP1 promotes malignant progression and facilitates immunosuppression by reprogramming glycolytic metabolism in cervical cancer[J]. Advanced Science, 2023, 10(32): 2302705. | IF: 12.8 Yang H H, Jiang H L, Tao J H, et al. Mitochondrial citrate accumulation drives alveolar epithelial cell necroptosis in lipopolysaccharide -induced acute lung injury[J]. Experimental & Molecular Medicine, 2022, 54(11): 2077-2091. |
![](_script:Site.hoverQrCode("//12794934.s61i.faiusr.com/4/AD0ItviMBhAEGAAgs6DslQYo1MGy9wcw0gE40gE.png",this);)
![](_script:Site.hoverQrCode("//12794934.s61i.faiusr.com/4/AD0ItviMBhAEGAAgouDulQYo7IavQzDIATjIAQ.png",this);)