Accelerate research, empower industry

Overview

Hysigen introduces the innovative "VIRUS-Free^TM system," a groundbreaking experimental model designed to significantly enhance the knockout efficiency of cell lines.

Key Advancements

• Utilizing state-of-the-art electroporation equipment to achieve higher electroporation efficiency and improved cell viability

• Employing our proprietary technology, ClonePlus^TM, increases the rate of positive monoclonal generation by 10-15 times

• Quick identification of large fragment removal through PCR analysis

• Enabling non-frame-shift knockouts, ensuring gene complementation in cell lines without concerns about mutation modification

Our achievements

Hysigen boasts a portfolio of over 100 successful cases across commonly used transfection-suitable cell lines. These include Jurkat, NK-92, BV2, C2C12, EMT6, B16-F10, ARPE-19, HepG2, THP-1, HCT116, A549, RAW264.7, MDA-MB-231, MDA-MB-468, 4T1, and more.

Workflow

* We kindly remind you that we provide gene editing services for primary cells, stem cells or iPS cells.

CRISPR-Mediated Gene Knockout CRISPR-mediated gene knockout involves using a synthetic guide RNA (gRNA) to direct the Cas9 enzyme to a specific location on the target gene's DNA. Once guided to the target site, Cas9 induces a precise double-strand break (DSB) in the DNA. Subsequent natural repair mechanisms, such as Non-Homologous End Joining (NHEJ) or Homology Directed Repair (HDR), are activated. NHEJ often introduces small insertions or deletions, disrupting the gene's reading frame and rendering it non-functional. The success of gene knockout is confirmed through molecular techniques, verifying the presence of mutations and the functional inactivation of the targeted gene. Our CRISPR/Cas9 system is highlighted by utilizing dual gRNAs to create dual DSBs to achieve 100% knockout of the target sequence.

Experimental design

Strategy

Identification results

PCR screening

Final Clone Sequences

#4C7:

AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT

*Point mutation: V617F