|
Overview We provide the Tet-On system to assist you in achieving precise and tetracycline dose-dependent control over the regulation of your Gene of Interest (GOI) expression.
Key Advancements
Workflow * We kindly remind you that we provide gene editing services for primary cells, stem cells or iPS cells.
PiggyBac with Tet-On system The PiggyBac transposon integrates the Tet-On system and the target gene into the chromosome of the host cell. The Tet-On system is a regulated gene expression mechanism, offering precise control over the activation of a target gene. It responds to the presence of tetracycline or its analogs (like Doxycycline). In the “off” state, the Tet-On system remains inactive, and the gene of interest (GOI) is not expressed. Upon introduction of tetracycline or its analogs, the system is triggered to turn “on”, allowing for the controlled and dose-dependent expression of the GOI. This inducible system enables researchers to finely regulate the timing and level of gene expression, offering versatility in experimental designs and facilitating the study of biological processes with a high degree of specificity. Experimental design Strategy Identification results PCR screening Final Clone Sequences #4C7: AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT *Point mutation: V617F Inducible Expression of CNTNAP2 in FaDu Cells Using Tet-On system
Project Summary · Project Objective: Stable gene expression using Tet-On system · Target Gene Name: CNTNAP2 · Target Gene ID: 26049 · Cell line : FaDu Cells Identification results qPCR Table Inducible Overexpression ![]() Experimental design Organism: Human Gene: CNTNAP2 Technique: PiggyBac with Tet-On system The PiggyBac transposon integrates the target gene into the chromosome of the host cell and when doxycycline was added to the system, the target gene was rapidly expressed at high levels. Vector Designed: |