Accelerate research, empower industry
|
|
Overview We provide the Tet-On system to assist you in achieving precise and tetracycline-dose-dependent control over the regulation of your Gene of Interest (GOI) expression.
Key Advancements
Workflow
* We kindly remind you that we provide gene editing services for primary cells, stem cells, or iPS cells.
PiggyBac with Tet-On System The PiggyBac transposon integrates the Tet-On system and the target gene into the chromosome of the host cell.
The Tet-On System is a regulated gene expression mechanism, offering precise control over the activation of a target gene. It responds to the presence of tetracycline or its analogs (like doxycycline). In the “off” state, the Tet-On system remains inactive, and the gene of interest (GOI) is not expressed. Upon introduction of tetracycline or its analogs, the system is triggered to turn “on," allowing for the controlled and dose-dependent expression of the GOI. This inducible system enables researchers to finely regulate the timing and level of gene expression, offering versatility in experimental designs and facilitating the study of biological processes with a high degree of specificity.
Experimental design Strategy
Identification results PCR screening
Final Clone Sequences #4C7: AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT
*Point mutation: V617F Generation of a Doxycycline-Inducible hKCNH2 Overexpression Stable Cell Line in HEK293 Cells
• Stable Cell Line Generation: HEK293 cells were co-transduced with two lentiviruses for the constitutive expression of rtTA and the Dox-inducible expression of the hKCNH2 gene (Fig. 1). • Clonal Isolation: Stable polyclonal cells were selected and enriched using drug-containing medium, followed by monoclonal isolation via ClonePlus™ technology. • Inducible Expression Validation: Dox-dependent induction of hKCNH2 mRNA expression was confirmed by QPCR analysis (Fig. 2). Figure 1. Lentiviral vector maps of the Tet-On hKCNH2 expression system.
Figure 2. Dox-dependent induction of hKCNH2 mRNA expression.
Figure 3. Dox-inducible EGFP expression in monoclonal HEK293 cells. |
|
|
|
|
|
|
|
|
|
IF: 45.5 Chen Y, Chen S, Liu Z, Wang Y, An N, Chen Y, Peng Y, Liu Z, Liu Q, Hu X. Red blood cells undergo lytic programmed cell death involving NLRP3. Cell. 2025 Apr 16:S0092-8674(25)00389-7. | IF: 39.3 Ma B, Ju A, Zhang S, et al. Albumosomes formed by cytoplasmic pre-folding albumin maintain mitochondrial homeostasis and inhibit nonalcoholic fatty liver disease[J]. Signal Transduction and Targeted Therapy, 2023, 8(1): 229. | IF: 26.6 Wu W, Pu Y, Gao S, et al. Bacterial Metabolism-Initiated Nanocatalytic Tumor Immunotherapy[J]. Nano-Micro Letters, 2022, 14(1): 1-21. | IF: 37.3 Zheng Z, Zeng X, Zhu Y, et al. CircPPAP2B controls metastasis of clear cell renal cell carcinoma via HNRNPC-dependent alternative splicing and targeting the miR-182- 5p/CYP1B1 axis[J]. Molecular Cancer, 2024, 23(1): 4. | IF: 18.9 Sun J, Yang F, Wang L, et al. Delivery of coenzyme Q10 loaded micelle targets mitochondrial ROS and enhances efficiency of mesenchymal stem cell therapy in intervertebral disc degeneration[J]. Bioactive Materials, 2023, 23: 247-260. | IF: 18.9 Wei X, Wang L, Duan C, et al. Cardiac patches made of brown adipose-derived stem cell sheets and conductive electrospun nanofibers restore infarcted heart for ischemic myocardial infarction[J]. Bioactive Materials, 2023, 27: 271-287. | IF: 16 Gao Y, Zhu Y, Wang H, et al. Lipid-mediated phase separation of AGO proteins on the ER controls nascent-peptide ubiquitination[J]. Molecular Cell, 2022, 82(7): 1313-1328. e8. | IF: 15.1 Chen X, Hao Y, Liu Y, et al. NAT10/ac4C/FOXP1 promotes malignant progression and facilitates immunosuppression by reprogramming glycolytic metabolism in cervical cancer[J]. Advanced Science, 2023, 10(32): 2302705. | IF: 12.8 Yang H H, Jiang H L, Tao J H, et al. Mitochondrial citrate accumulation drives alveolar epithelial cell necroptosis in lipopolysaccharide -induced acute lung injury[J]. Experimental & Molecular Medicine, 2022, 54(11): 2077-2091. |
![](_script:Site.hoverQrCode("//12794934.s61i.faiusr.com/4/AD0ItviMBhAEGAAgs6DslQYo1MGy9wcw0gE40gE.png",this);)
![](_script:Site.hoverQrCode("//12794934.s61i.faiusr.com/4/AD0ItviMBhAEGAAgouDulQYo7IavQzDIATjIAQ.png",this);)