Accelerate research, empower industry

CRISPR/Cas9-mediated gene knockout (KO)CRISPR/Cas9-mediated gene knockin (KI)CRISPR/Cas9-mediated gene point-mutationInducible Gene Over-expression (Tet-On)shRNA Knockdown cell serviceCRISPR-KO libraryCRISPRa libraryCRISPRi libraryCRISPRSeek™ library screening serviceCRISPRSeek™ Library PlasmidCRISPRSeek™ Library VirusCRISPRSeek™ Library Cell PoolCRISPRSeek™ Library ProductsHySigen Vector LibraryVB163VB164VB203VB204VB205VB303VB271VB272VB188VB278VB180VB251VB252Custom Vector Construction ServiceCustom Vector Construction Service-1Lentivirus PackagingshRNA AAVAdeno-Associated Virus (AAV) PackagingOver-expression AAVIn-stock virusesVirus PackagingCustomized Peptide SynthesisHuman cell linesAnimal cell linesCell LinesKO cell linesPoint mutation cell linesKI cell linesFluorescence-tag cell linesStable cell linesOff-the-shelf gene-edited cell linesOne-step freezing medium for stem cellsOne-step freezing medium for PBMCsCell freezing mediaOsteogenic differentiation culture mediumAdipogenic differentiation culture mediumChondrogenic differentiation culture mediumStem cell differentiation mediaStem cell culture mediaKnockout Cell LinesKnockin Cell LinesPoint mutation cell lineInducible Gene ExpressionGenome-Wide Libraries at Unbeatable PricesWho we arePartnersDistributorsTechnical PlatformsNews & eventsPublicationsResourcesPrivacy policySupportContact UsSubmitted successfully
Gene Knock in Service


Overview

The Cas9-Cell Line Knock-in service (Cas9-CKI) is designed to address challenges related to low knock-In (KI) efficiency due to in KI fragment length.


Key Advancements

  • HySigen employs tailored KI strategies based on fragment lengths and specific cell characteristics:

    - For small fragment, Oligo is utilized

    - For longer fragment, single-stranded DNA (ssDNA) is utilized

    - Recombination of the method is employed for KI when the length exceeds 1 kb

  • HySigen is committed to refining experimental conditions to cater to the diverse requirements of KI services for varying cell lines and

    fragment lengths

Our achievements

With a track record of over 100 successful cases, HySigen has demonstrated proficiency in transfection-suitable cell lines, including Jurkat,

NK-92, BV2, C2C12, EMT6, B16-F10, ARPE-19, HepG2, THP-1, HCT116, A549, RAW264.7, MDA-MB-231, MDA-MB-468, 4T1,

and others.


Workflow

KI流程图.jpg

* We kindly remind you that we provide gene editing services for primary cells, stem cells, or iPS cells.

Deliverables

Stable Cell Line Model

Approach

Cell Type

Price

Turnaround

Deliverables

Gene Knock-in

RNP (Fragment<

3 kb) heterozygote

Easy

$6,499

14-20 weeks

One heterozygous single clone, each clone with two vials of cells (>10^6 cells/vial)

Normal

$6,599

16-23 weeks

Difficult

$9,099

21-28 weeks

RNP (Fragment>

3 kb) heterozygote

Easy

$7,199

18-25 weeks

Normal

$9,099

18-25 weeks

Difficult

$11,199

23-30 weeks

Technical Information


ABUIABAEGAAg6_i-qwYovML_rQIwswQ4qgM

CRISPR-Mediated Gene Knock-in CRISPR-mediated gene knock-in (KI) involves the precise insertion of a desired genetic sequence into the genome using the CRISPR-Cas9 system. Initially, a guide RNA (gRNA) is designed to match the target DNA sequence, guiding the Cas9 enzyme to a specific genomic location. Unlike knockout, knock-in introduces a foreign DNA fragment or a modified sequence at the designated site. The introduced DNA can be a gene, a reporter, or any other sequence of interest. To facilitate knock-in, a donor DNA template containing the desired sequence is provided along with the Cas9-sgRNA complex. The cell's repair machinery, particularly Homology Directed Repair (HDR), incorporates the donor DNA into the genome precisely at the cut site. This CRISPR-mediated gene knock-in mechanism allows for the targeted addition of genetic material, enabling researchers to introduce specific modifications or genes into the genome with high precision.

Example

Experimental design

Strategy

Identification results

PCR screening

Final Clone Sequences

#4C7:

AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT

*Point mutation: V617F

Knock-in of EGFP into the SOX9 in NCI-N87 Cells

• Genetic Editing & Transfection: Using the CRISPR/Cas9 system, gRNA and a donor vector were designed and synthesized for the site-specific insertion of EGFP into the SOX9 gene (Fig. 1). These components were delivered into NCI-N87 cells via optimized electroporation, achieving high-efficiency knock-in.

• Single-Cell Cloning: Single cells were isolated using ClonePlus™ technology to ensure monoclonality.

• Screening & Scale-Up: Genomic DNA from monoclonal populations was analyzed by PCR and sequencing to confirm on-target editing and successful knock-in (Fig. 2). The verified positive clone was then expanded in culture.


Figure 1. EGFP-SOX9 knock-in strategy

KI-case1.jpg


Figure 2. PCR analysis of the EGFP-SOX9 knock-in in NCI-N87 cells.

KI-case2.jpg


Figure 3. Fluorescence Confirmation of the Positive Clone

KI-case3.jpg

Publications

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

微信图片_20250916135600_813_180.jpg

8_看图王.web.png

IF: 45.5

Chen Y, Chen S, Liu Z, Wang Y, An N,

Chen Y, Peng Y, Liu Z, Liu Q, Hu X.

Red blood cells undergo lytic

programmed cell death involving

NLRP3. Cell. 2025 Apr 16:S0092-8674(25)00389-7.


IF: 39.3

Ma B, Ju A, Zhang S, et al.

Albumosomes formed by

cytoplasmic pre-folding

albumin maintain mitochondrial

homeostasis and inhibit nonalcoholic

fatty liver disease[J]. Signal

Transduction and Targeted Therapy,

2023, 8(1): 229.

IF: 26.6

Wu W, Pu Y, Gao S, et al. Bacterial

Metabolism-Initiated Nanocatalytic

Tumor Immunotherapy[J].

Nano-Micro Letters, 2022, 14(1):

1-21.

IF: 37.3

Zheng Z, Zeng X, Zhu Y, et al.

CircPPAP2B controls metastasis of

clear cell renal cell carcinoma via

HNRNPC-dependent alternative

splicing and targeting the miR-182-

5p/CYP1B1 axis[J]. Molecular Cancer,

2024, 23(1): 4.

IF: 18.9

Sun J, Yang F, Wang L, et al. Delivery

of coenzyme Q10 loaded micelle

targets mitochondrial ROS and

enhances efficiency of mesenchymal

stem cell therapy in intervertebral

disc degeneration[J]. Bioactive

Materials, 2023, 23: 247-260.

IF: 18.9

Wei X, Wang L, Duan C, et al. Cardiac

patches made of brown adipose-derived

stem cell sheets and conductive

electrospun nanofibers restore infarcted

heart for ischemic myocardial infarction[J]. Bioactive Materials, 2023, 27: 271-287.

IF: 16

Gao Y, Zhu Y, Wang H, et al.

Lipid-mediated phase separation of

AGO proteins on the ER controls

nascent-peptide ubiquitination[J].

Molecular Cell, 2022, 82(7):

1313-1328. e8.

IF: 15.1

Chen X, Hao Y, Liu Y, et al.

NAT10/ac4C/FOXP1 promotes

malignant progression and

facilitates immunosuppression by

reprogramming glycolytic

metabolism in cervical cancer[J].

Advanced Science, 2023, 10(32):

2302705.

IF: 12.8

Yang H H, Jiang H L, Tao J H, et al.

Mitochondrial citrate accumulation

drives alveolar epithelial cell

necroptosis in lipopolysaccharide

-induced acute lung injury[J].

Experimental & Molecular Medicine,

2022, 54(11): 2077-2091.

Contact us
Name
*
Country/Region
*
How would you like us to contact you?
*
E-mail
*
Institution
Phone
Subject
*
Where did you learn about HySigen?
  • Instagram: hysigenbiosciences
  • WhatsAPP: +1(909)352-8083
Verification code
 Change Image
*
Submit
Tell Us Your Demand
Contact Us


Address: 56 Sugar Creek Blvd Suite 375,
Sugar Land, TX 77478

Email: info@hysigen.com

Telephone: +1 (909) 352-8083 (US)

Accelerate research, empower industry