|
Overview The Cas9-Cell Line Knock-in service (Cas9-CKI) is designed to address challenges related to low Knock-In (KI) efficiency limitations in KI fragment length. Key Advancements
Our achievements With a track record of over 100 successful cases, Hysigen has demonstrated proficiency in transfection-suitable cell lines, including Jurkat, NK-92, BV2, C2C12, EMT6, B16-F10, ARPE-19, HepG2, THP-1, HCT116, A549, RAW264.7, MDA-MB-231, MDA-MB-468, 4T1, among others. Workflow * We kindly remind you that we provide gene editing services for primary cells, stem cells or iPS cells.
![]() CRISPR-Mediated Gene Knockin CRISPR-mediated gene knock-in (KI) involves the precise insertion of a desired genetic sequence into the genome using the CRISPR-Cas9 system. Initially, a guide RNA (gRNA) is designed to match the target DNA sequence, guiding the Cas9 enzyme to a specific genomic location. Unlike knockout, knock-in introduces a foreign DNA fragment or a modified sequence at the designated site. The introduced DNA can be a gene, a reporter, or any other sequence of interest. To facilitate knock-in, a donor DNA template containing the desired sequence is provided along with the Cas9-sgRNA complex. The cell's repair machinery, particularly Homology Directed Repair (HDR), incorporates the donor DNA into the genome precisely at the cut site. This CRISPR-mediated gene knock-in mechanism allows for the targeted addition of genetic material, enabling researchers to introduce specific modifications or genes into the genome with high precision. Experimental design Strategy Identification results PCR screening Final Clone Sequences #4C7: AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT *Point mutation: V617F Knockin GFP in VPS35 of HEK293 Cells Using CRISPR/Cas9
Experimental design: Reference transcript: VPS35-201 Technique: CRISPR/Cas9 Strategy: A fragment containing {EGFP/3xFLAG: LoxP/mPGK} was inserted at the C-terminus of the human VPS35 gene.
Identification results: PCR screening
Final Clone Sequences *EGFP was successfully inserted at the C-terminus of the human VPS35 gene.
|