Accelerate research, empower industry

Overview

The Cas9-Cell Line Knock-in service (Cas9-CKI) is designed to address challenges related to low knock-In (KI) efficiency due to in KI fragment length.

Key Advancements

• Hysigen employs tailored KI strategies based on fragment lengths and specific cell characteristics:

  - For small fragment, Oligo is utilized

  - For longer fragment, single-stranded DNA (ssDNA) is utilized

  - Recombination of the method is employed for KI when the length exceeds 1 kb

• Hysigen is committed to refining experimental conditions to cater to the diverse requirements of KI services for varying cell lines and

  fragment lengths

Our achievements

With a track record of over 100 successful cases, Hysigen has demonstrated proficiency in transfection-suitable cell lines, including Jurkat,

NK-92, BV2, C2C12, EMT6, B16-F10, ARPE-19, HepG2, THP-1, HCT116, A549, RAW264.7, MDA-MB-231, MDA-MB-468, 4T1,

and others.

Workflow

* We kindly remind you that we provide gene editing services for primary cells, stem cells, or iPS cells.

CRISPR-Mediated Gene Knock-in CRISPR-mediated gene knock-in (KI) involves the precise insertion of a desired genetic sequence into the genome using the CRISPR-Cas9 system. Initially, a guide RNA (gRNA) is designed to match the target DNA sequence, guiding the Cas9 enzyme to a specific genomic location. Unlike knockout, knock-in introduces a foreign DNA fragment or a modified sequence at the designated site. The introduced DNA can be a gene, a reporter, or any other sequence of interest. To facilitate knock-in, a donor DNA template containing the desired sequence is provided along with the Cas9-sgRNA complex. The cell's repair machinery, particularly Homology Directed Repair (HDR), incorporates the donor DNA into the genome precisely at the cut site. This CRISPR-mediated gene knock-in mechanism allows for the targeted addition of genetic material, enabling researchers to introduce specific modifications or genes into the genome with high precision.

Experimental design

Strategy

Identification results

PCR screening

Final Clone Sequences

#4C7:

AAGCAGCAAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAGCAT

*Point mutation: V617F